ID: 985704988_985704990

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 985704988 985704990
Species Human (GRCh38) Human (GRCh38)
Location 5:1395234-1395256 5:1395251-1395273
Sequence CCCGCGCGGGCGCAAGTGCAGCG GCAGCGTGTACTGACTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 44} {0: 1, 1: 0, 2: 0, 3: 9, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!