ID: 985710152_985710168

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 985710152 985710168
Species Human (GRCh38) Human (GRCh38)
Location 5:1423340-1423362 5:1423393-1423415
Sequence CCACAGTGCTGCCCACGCTGCTG AGGGTCCCTCTCCAGGGATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!