ID: 985721062_985721063

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 985721062 985721063
Species Human (GRCh38) Human (GRCh38)
Location 5:1489305-1489327 5:1489318-1489340
Sequence CCAAGCTAATGTCAGCCAGGCTG AGCCAGGCTGCCCCTACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 202} {0: 1, 1: 0, 2: 1, 3: 24, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!