ID: 985724268_985724278

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 985724268 985724278
Species Human (GRCh38) Human (GRCh38)
Location 5:1507521-1507543 5:1507561-1507583
Sequence CCCAGGGCTCCTCAGCCGGGCTT GGAAATGCAGAGATGAAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 221} {0: 1, 1: 0, 2: 7, 3: 55, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!