ID: 985725692_985725700

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 985725692 985725700
Species Human (GRCh38) Human (GRCh38)
Location 5:1514803-1514825 5:1514843-1514865
Sequence CCTTCCACCTCCAGCCAAAACAG GCACGCTTCCCATTCAGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!