ID: 985784571_985784573

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 985784571 985784573
Species Human (GRCh38) Human (GRCh38)
Location 5:1887061-1887083 5:1887077-1887099
Sequence CCTGCGGTGGCGCTGGGCCGCTC GCCGCTCCCGGCAGCCCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 122} {0: 1, 1: 0, 2: 2, 3: 27, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!