ID: 985788311_985788316

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 985788311 985788316
Species Human (GRCh38) Human (GRCh38)
Location 5:1911411-1911433 5:1911446-1911468
Sequence CCATAGAAGGCTGCCTCCGCCTG CATGTTCAGCAGTCAGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 113} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!