ID: 985795823_985795827

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 985795823 985795827
Species Human (GRCh38) Human (GRCh38)
Location 5:1961605-1961627 5:1961618-1961640
Sequence CCAGGTGGAGCCACGTCCTGGTC CGTCCTGGTCACTCGGATTCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!