ID: 985819867_985819872

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 985819867 985819872
Species Human (GRCh38) Human (GRCh38)
Location 5:2152320-2152342 5:2152366-2152388
Sequence CCATTTACACTCTCATTGCACAG CTCATTGCACAGATGGAAGATGG
Strand - +
Off-target summary No data {0: 3, 1: 5, 2: 1, 3: 28, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!