ID: 985863658_985863666

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 985863658 985863666
Species Human (GRCh38) Human (GRCh38)
Location 5:2494800-2494822 5:2494849-2494871
Sequence CCTTTCACGGTGTCCCTCAGAAG GACACAGCTGCTGTGGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!