ID: 985863909_985863914

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 985863909 985863914
Species Human (GRCh38) Human (GRCh38)
Location 5:2496374-2496396 5:2496396-2496418
Sequence CCTGCCAGCACCCTGGTCTCCGA ACTCCCAGCTTCCAGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 603} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!