ID: 985896516_985896526

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 985896516 985896526
Species Human (GRCh38) Human (GRCh38)
Location 5:2752275-2752297 5:2752327-2752349
Sequence CCGCGGCTCGGGTCTTCCTCCGG CCCGGACCTGCTCTGCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143} {0: 1, 1: 0, 2: 2, 3: 57, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!