ID: 985901672_985901683

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 985901672 985901683
Species Human (GRCh38) Human (GRCh38)
Location 5:2800610-2800632 5:2800651-2800673
Sequence CCCTGTTTGCCCTCTACTCAGCC GTGGGGAAACGGAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!