ID: 985903289_985903305

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 985903289 985903305
Species Human (GRCh38) Human (GRCh38)
Location 5:2813765-2813787 5:2813814-2813836
Sequence CCTGGCCTCAGAGGCTGACCCTG CTGCCAGGGGAGGTAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 472} {0: 1, 1: 0, 2: 3, 3: 40, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!