ID: 985948098_985948107

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 985948098 985948107
Species Human (GRCh38) Human (GRCh38)
Location 5:3202231-3202253 5:3202268-3202290
Sequence CCCTGCACCTGCAGCCTGTCACC CTCCAGCAATGAGGTCCTCTCGG
Strand - +
Off-target summary No data {0: 5, 1: 1, 2: 2, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!