ID: 985962544_985962551

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 985962544 985962551
Species Human (GRCh38) Human (GRCh38)
Location 5:3313619-3313641 5:3313648-3313670
Sequence CCACGATTTCCAACCTACAGATA TGGAGGTCCCAGGTCTACCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!