ID: 985985952_985985968

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 985985952 985985968
Species Human (GRCh38) Human (GRCh38)
Location 5:3516480-3516502 5:3516532-3516554
Sequence CCCGTGATCCAATCAAATCCCAC TGTCAACATGAGATTTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 255, 3: 2982, 4: 6320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!