ID: 985987977_985987987

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 985987977 985987987
Species Human (GRCh38) Human (GRCh38)
Location 5:3533369-3533391 5:3533420-3533442
Sequence CCTGAAGATGAGGGCCCCACAGT TCTGGGGCCCCTCCCAGAGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 49, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!