ID: 985994101_985994111

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 985994101 985994111
Species Human (GRCh38) Human (GRCh38)
Location 5:3587088-3587110 5:3587121-3587143
Sequence CCAGGGATGCCCATGCACCGAGT CGACACAACAAGAGGCTGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!