ID: 986023341_986023345

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 986023341 986023345
Species Human (GRCh38) Human (GRCh38)
Location 5:3825375-3825397 5:3825396-3825418
Sequence CCCAGGACAGCCGTCCACATGCG CGTCCACGTGAAGTCCCCTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!