ID: 986037625_986037630

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 986037625 986037630
Species Human (GRCh38) Human (GRCh38)
Location 5:3955451-3955473 5:3955495-3955517
Sequence CCTATCAACCACCATGGCACATG CTCATTCTGCACATTTATCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 20, 3: 286, 4: 870}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!