ID: 986081403_986081411

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 986081403 986081411
Species Human (GRCh38) Human (GRCh38)
Location 5:4398611-4398633 5:4398632-4398654
Sequence CCACGCCGGTGTTCCTCACAGGC GCCCCCCAGGGTAGGGGCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 35, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!