ID: 986149311_986149316

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 986149311 986149316
Species Human (GRCh38) Human (GRCh38)
Location 5:5112366-5112388 5:5112394-5112416
Sequence CCAGACTCCCCTTAATTATTATG ATAATTATTATACATATTTATGG
Strand - +
Off-target summary No data {0: 3, 1: 95, 2: 646, 3: 1761, 4: 4016}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!