ID: 986152536_986152545

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 986152536 986152545
Species Human (GRCh38) Human (GRCh38)
Location 5:5140442-5140464 5:5140469-5140491
Sequence CCCCTAGCCCCTCGGAGCGCTCC TGAAGCCCCGCGCGCGCGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103} {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!