|
Left Crispr |
Right Crispr |
| Crispr ID |
986165247 |
986165254 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:5267305-5267327
|
5:5267325-5267347
|
| Sequence |
CCCTTTGCCTTATCCCGAGGACA |
ACAGAGGGCTTTCTGTATCCTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 158, 1: 206, 2: 114, 3: 62, 4: 202} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|