ID: 986165247_986165256

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 986165247 986165256
Species Human (GRCh38) Human (GRCh38)
Location 5:5267305-5267327 5:5267338-5267360
Sequence CCCTTTGCCTTATCCCGAGGACA TGTATCCTGGGTTATCGCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 52, 3: 79, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!