ID: 986178989_986178992

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 986178989 986178992
Species Human (GRCh38) Human (GRCh38)
Location 5:5376106-5376128 5:5376121-5376143
Sequence CCTGGGCCACCAGTAGAGGGTAA GAGGGTAAACAGCAAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 91} {0: 1, 1: 0, 2: 2, 3: 34, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!