ID: 986187113_986187115

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 986187113 986187115
Species Human (GRCh38) Human (GRCh38)
Location 5:5454386-5454408 5:5454410-5454432
Sequence CCTTTTTATCAGTAACTGACTGT TTGTGCACAATGGTTGAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 229} {0: 1, 1: 1, 2: 0, 3: 10, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!