ID: 986211772_986211775

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 986211772 986211775
Species Human (GRCh38) Human (GRCh38)
Location 5:5680211-5680233 5:5680242-5680264
Sequence CCCAATGAATTCTAATAAATACG GAACTCACTCCTTGCACTATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!