ID: 986299770_986299771

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 986299770 986299771
Species Human (GRCh38) Human (GRCh38)
Location 5:6468690-6468712 5:6468723-6468745
Sequence CCTTCAATTCTACTTCTTAGGAG AGTTAACTTATAGTTACTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 296} {0: 1, 1: 0, 2: 1, 3: 24, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!