ID: 986318614_986318624

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 986318614 986318624
Species Human (GRCh38) Human (GRCh38)
Location 5:6609364-6609386 5:6609415-6609437
Sequence CCGGGCTGCATCTTTCTAGCCAG CAGCCAAGGTGAACCCGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 193} {0: 1, 1: 0, 2: 2, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!