ID: 986332087_986332095

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 986332087 986332095
Species Human (GRCh38) Human (GRCh38)
Location 5:6724870-6724892 5:6724911-6724933
Sequence CCTGGGAGAGGCTGTTCTCGGCA ACAGCTGGTAGGTGTAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!