ID: 986333586_986333594

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 986333586 986333594
Species Human (GRCh38) Human (GRCh38)
Location 5:6736191-6736213 5:6736230-6736252
Sequence CCTAGCCTTAAGCCCTCTGTGGA CTCCAAATGACTCTTTTGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!