ID: 986333686_986333695

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 986333686 986333695
Species Human (GRCh38) Human (GRCh38)
Location 5:6736915-6736937 5:6736962-6736984
Sequence CCTGTTTCTCTCTGCTGAGACTG GGATGGTCACCAGGTAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 304} {0: 1, 1: 1, 2: 1, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!