ID: 986404896_986404902

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 986404896 986404902
Species Human (GRCh38) Human (GRCh38)
Location 5:7416003-7416025 5:7416028-7416050
Sequence CCATGATGGGGAGAAGAGAGCCA GAGGGTACACTGCTGTAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 247} {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!