ID: 986430939_986430945

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 986430939 986430945
Species Human (GRCh38) Human (GRCh38)
Location 5:7680319-7680341 5:7680345-7680367
Sequence CCCCCACAGCAAAGAGCCATGTC CAAAATGCTGATAGCGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 176} {0: 1, 1: 0, 2: 0, 3: 18, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!