ID: 986439469_986439471

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 986439469 986439471
Species Human (GRCh38) Human (GRCh38)
Location 5:7767047-7767069 5:7767075-7767097
Sequence CCTTCTTCTCTTAACCACTACAG CTAGCATATTTCCTACCATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!