ID: 986478299_986478310

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 986478299 986478310
Species Human (GRCh38) Human (GRCh38)
Location 5:8158503-8158525 5:8158530-8158552
Sequence CCCCTCCCAAGTGCAGGTTCCTG CACCAGCGTGGCTATGCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!