ID: 986480764_986480772

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 986480764 986480772
Species Human (GRCh38) Human (GRCh38)
Location 5:8184685-8184707 5:8184715-8184737
Sequence CCACCAGCCCTCTCATCCAAGTG TGGATCTTGCCCATATTATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!