ID: 986481163_986481168 |
View in Genome Browser |
Spacer: -2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 986481163 | 986481168 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:8189620-8189642 | 5:8189641-8189663 |
Sequence | CCCTACATAGCCTGGAAAGCAGA | GAATCCACAAATAGCAAAAGGGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |