ID: 986514916_986514923

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 986514916 986514923
Species Human (GRCh38) Human (GRCh38)
Location 5:8551265-8551287 5:8551282-8551304
Sequence CCACTCTTCCAAGGAGGCCAGAA CCAGAATCTGGTGGGGTCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 42, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!