ID: 986573031_986573035

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 986573031 986573035
Species Human (GRCh38) Human (GRCh38)
Location 5:9184768-9184790 5:9184798-9184820
Sequence CCTTTTTTTTCCAAGCAAAGTAA GCACATGTCCTGCTCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 56, 4: 611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!