|
Left Crispr |
Right Crispr |
| Crispr ID |
986582313 |
986582320 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:9278698-9278720
|
5:9278718-9278740
|
| Sequence |
CCCAGCTCCAGCTATGGCTAAAG |
AAGGGGCCAAGGTACAGCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 12, 3: 43, 4: 242} |
{0: 306, 1: 827, 2: 1320, 3: 1370, 4: 1281} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|