ID: 986597507_986597515

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 986597507 986597515
Species Human (GRCh38) Human (GRCh38)
Location 5:9439064-9439086 5:9439092-9439114
Sequence CCTGCCTGAGACGCCCCAGCAGC CACCCTCATATCGTGCAGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 1060, 4: 16786} {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!