ID: 986598837_986598840

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 986598837 986598840
Species Human (GRCh38) Human (GRCh38)
Location 5:9450949-9450971 5:9450995-9451017
Sequence CCATAAGAGAAATCAGCCTAATA AAAGGCTTGTATAACTCTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!