ID: 986601624_986601636

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 986601624 986601636
Species Human (GRCh38) Human (GRCh38)
Location 5:9478599-9478621 5:9478647-9478669
Sequence CCTTCTCAGTTTTGGACTTGCAT CAAGTTCTCCCTTTTGGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 26, 3: 307, 4: 1227} {0: 3, 1: 125, 2: 781, 3: 1257, 4: 1320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!