ID: 986608530_986608548

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 986608530 986608548
Species Human (GRCh38) Human (GRCh38)
Location 5:9545875-9545897 5:9545926-9545948
Sequence CCTGGGTGGGAGAAGGGAGCGTC CCCTGCACGGGGAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 273} {0: 1, 1: 0, 2: 4, 3: 23, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!