|
Left Crispr |
Right Crispr |
| Crispr ID |
986617884 |
986617891 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:9638777-9638799
|
5:9638795-9638817
|
| Sequence |
CCTTGAGTGGGGCTTGCCACAGC |
ACAGCCACTGTGGGGGATGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 14, 3: 56, 4: 248} |
{0: 2, 1: 5, 2: 21, 3: 114, 4: 546} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|