ID: 986651739_986651750

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 986651739 986651750
Species Human (GRCh38) Human (GRCh38)
Location 5:9970907-9970929 5:9970945-9970967
Sequence CCTGCAAAGGAGGCAACTCCGCA CAGGCTCACCTCAGGCACCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!