ID: 986661567_986661583

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 986661567 986661583
Species Human (GRCh38) Human (GRCh38)
Location 5:10064697-10064719 5:10064732-10064754
Sequence CCCAGGTGGCTGTCCCCGGACCC CCTGGTGGCCAGGGCCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!